View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14411_high_19 (Length: 411)
Name: NF14411_high_19
Description: NF14411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14411_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 20 - 404
Target Start/End: Complemental strand, 41581628 - 41581244
Alignment:
| Q |
20 |
caaaagagatggtggattaccttattgaaatctcaaagagatagatgcaaaaggcagagaaagcagcacaagcatgagaagcaaaagggtcacattgcga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41581628 |
caaaagagatggtggattaccttattgaaatctcaaagagatagatgcaaaaggcagagaaagcagcacaagcatgagaagcaaaagggtcacattgcga |
41581529 |
T |
 |
| Q |
120 |
aaccatattttttatttgtatcagtcgtggtcgttttgcttgcgaattagattcattttcctttgtaaacaacaattatgaatttatgatactttatgta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41581528 |
aaccatattttttatttgtatcagtcgtggtcgttttgcttgcgaattggattcattttcctttgtaaacaacaattatgaatttatgatactttatgta |
41581429 |
T |
 |
| Q |
220 |
tgtgttaagtggcttgacataattgccatagtgatttctatttgtttgcaaatgattgcttgattaaaagtgggtattatggtagttttaacaaaggagg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41581428 |
tgtgttaagtggcttgacataattgccatagtgatttctatttgtttgcaaatgattgcttgattaaaagtgggtattatggtagttttaacaaaggagg |
41581329 |
T |
 |
| Q |
320 |
cgaatgaactgagtaggtgaaagattcgaccatcaaattgagagggaacatttaacgaatatgcgcttgctatacccctttgcta |
404 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41581328 |
cgaatgaactgagtaggtggaagattcgaccatcaaattgagagggaacatttaacgaatatgcgcttgctatacccttttgcta |
41581244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University