View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14411_high_46 (Length: 224)

Name: NF14411_high_46
Description: NF14411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14411_high_46
NF14411_high_46
[»] chr4 (1 HSPs)
chr4 (21-206)||(36239451-36239636)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 21 - 206
Target Start/End: Complemental strand, 36239636 - 36239451
Alignment:
21 aaccctaacagtaacactcctcttgaaggttcaacttctcacacttcaaattcagtttcatcagttgctagatcgcttctcccaacacgacgtcgtctca 120  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
36239636 aaccctaacagtaacactcctcttgaaggttcaacttctcacacttcaaattcagtttcatctgttgctagatcgcttctcccaacacgacgtcgtctca 36239537  T
121 agcttgatccttctaacaaactttacttcccttgtatgtctgctgctcannnnnnnatgtttctgttttactttgcttgcaattta 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||    
36239536 agcttgatccttctaacaaactttacttcccttgtatgtctgctgctcatttttttatgtttctgttttactttgcttgcaattta 36239451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University