View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14411_high_9 (Length: 499)
Name: NF14411_high_9
Description: NF14411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14411_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 117 - 352
Target Start/End: Complemental strand, 31054542 - 31054307
Alignment:
| Q |
117 |
tgcatcaacttaacttataatctccaaaattaccatcaccgaataatgactagtgatatatcactaaaa-ttatggaaaatcccctataatttggatggt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
31054542 |
tgcatcaacttaacttataatctccaaaattaccatcaccgaacaatgaccagtgatatatcactaaaaattatggaaaatcccctata-tttggatggt |
31054444 |
T |
|
| Q |
216 |
atgatatctctaatggtggactcttgttttatatgtatatattcccatctctcgtgtacaaacactcgatatgggacttttgttttggcaatgttagtaa |
315 |
Q |
| |
|
| |||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31054443 |
aagatatctcaaatggtggactcttgttttatatgtatatattcctatctctcgtgtacagacactcgatatgggacttttgttttggcaatgttagtaa |
31054344 |
T |
|
| Q |
316 |
aattacttttgctttctttcccaattcctttcatcag |
352 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31054343 |
aattaattttgctttctttcccaattcctttcatcag |
31054307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 25 - 84
Target Start/End: Complemental strand, 31054624 - 31054565
Alignment:
| Q |
25 |
attttaaattatgttttaatatattgccattatttgaatgatcgtaaccatggaaattac |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| | ||| ||||||||||| |
|
|
| T |
31054624 |
attttaaattatgttttaatatattgccattattcgaatgactggaactatggaaattac |
31054565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 6e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 372 - 457
Target Start/End: Original strand, 53451325 - 53451410
Alignment:
| Q |
372 |
agattggataagaaaatcattcttaccgaaacattaagcagttctggttacttgattaattgttgattcacttccaaaagggaacc |
457 |
Q |
| |
|
||||| ||||||||||| |||||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53451325 |
agatttgataagaaaataattcttaccgaaccattaagcagttctgggtgcttgattaattgttgattcacttccaaaagggaacc |
53451410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University