View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14411_low_22 (Length: 390)
Name: NF14411_low_22
Description: NF14411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14411_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 8e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 8e-80
Query Start/End: Original strand, 214 - 380
Target Start/End: Original strand, 26541586 - 26541752
Alignment:
| Q |
214 |
tcacctcaaattcatactttaccattgaactctccatcttaagtctaattatattcttgtaattgttggatacttattaaacttactattttctgcttct |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
26541586 |
tcacctcaaattcatactttaccattgaactctccatcttaagtctagttatattcttgtaattgttggatacttattgaacttactcttttctgcttct |
26541685 |
T |
|
| Q |
314 |
atgcacaatgttttcttttcttgttgccatcattagcatactcgatcccacttgtattcttatcact |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26541686 |
atgcacaatgttttcttttcttgttgccatcattagcatactcgatcccacttgtattcttttcact |
26541752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 21 - 61
Target Start/End: Original strand, 26541502 - 26541542
Alignment:
| Q |
21 |
tttaatcacagattaaataatttcatccccacacttcctcg |
61 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
26541502 |
tttaatcacaaattaaataatttcatctccacacttcctcg |
26541542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University