View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14411_low_36 (Length: 259)
Name: NF14411_low_36
Description: NF14411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14411_low_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 9e-79; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 4 - 156
Target Start/End: Original strand, 5143166 - 5143318
Alignment:
| Q |
4 |
tagtatgagaaaacgaacccttcgaggtacaggtgcagaattgaaaacctgttccaccatccttgccagtaacgccgtgtattcctccattacctccgct |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5143166 |
tagtatgagaaaacgaacccttcgaggtacaggtgcagaattgaaaacctgttccaccatccttgccagtaacgccgtgtattcctccatcacctccgct |
5143265 |
T |
|
| Q |
104 |
acaatcgccaccagtatcatctttctagttgaatttgaatccaaatgaaatat |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5143266 |
acaatcgccaccagtatcatctttctagttgaatttgaatccaaatgaaatat |
5143318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 186 - 240
Target Start/End: Original strand, 5143365 - 5143419
Alignment:
| Q |
186 |
atatataaggagagtgggtgacttgagtagctggtaatatttcacagttttgtta |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5143365 |
atatataaggagagtgggtgacttgagtagctggtaatatttgacagttttgtta |
5143419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University