View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14411_low_43 (Length: 240)

Name: NF14411_low_43
Description: NF14411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14411_low_43
NF14411_low_43
[»] chr8 (2 HSPs)
chr8 (1-156)||(36055336-36055491)
chr8 (181-224)||(36055626-36055669)


Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 36055336 - 36055491
Alignment:
1 atagagatatgaaatagtcaacgagacttttcgaaagaatcaattttaaaataaatcaattataaagttggatcataatattaaactcgttcataaatgc 100  Q
    |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||    
36055336 atagagatatgagatagtcaacgagacttttcgaaagaatcaactttaaaataaatcaattttaaagttggatcataatattaaattcgttcataaatgc 36055435  T
101 aaaccaattatgaaccgattttaaactaaattggaaatggtttgacaattaactgg 156  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36055436 aaaccaattatgaaccgattttaaactaaattggaaatggtttgacaattaactgg 36055491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 181 - 224
Target Start/End: Original strand, 36055626 - 36055669
Alignment:
181 atatagcgagaaaattcataccaagataatcacgacgtgcaaat 224  Q
    ||||||||||||||||||| ||||||||||||||||||||||||    
36055626 atatagcgagaaaattcatcccaagataatcacgacgtgcaaat 36055669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University