View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14411_low_44 (Length: 235)
Name: NF14411_low_44
Description: NF14411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14411_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 43225794 - 43226014
Alignment:
| Q |
1 |
gtcttcgtttttattgtcttcacacccttaaccaagcatatatgatgaagttagcatggtctatgattacccatcccgataaactttgggtgaaattttt |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43225794 |
gtcttcgttttcattgtcttcacacccttaaccaagcatatatgatgaagttagcatggtctatgattacccatcccgataaactttgggtgaaattttt |
43225893 |
T |
 |
| Q |
101 |
tcgtgccaagtactcttacaaggaacaaactctccctttaatagagcaccaccattgtgacatttgtgtttgaagaagtatcaccaaagtttagcaacgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43225894 |
tcgtgccaagtactcttacaaggaacaaactctccctttagtagagcaccaccattgtgacatttgtgtttgaagaagtatcaccaaagtttagcaacgt |
43225993 |
T |
 |
| Q |
201 |
ggggaggtcaattgttattgt |
221 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
43225994 |
ggggaggtcaatagttattgt |
43226014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University