View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14411_low_46 (Length: 228)
Name: NF14411_low_46
Description: NF14411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14411_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 414607 - 414812
Alignment:
| Q |
1 |
tcttcttttttcatactactggtttatgatttctctttctcagtgcatttagaactgttatgattttaagactatgttgtttcccgactcatgcatgact |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
414607 |
tcttcttgtttcatactactggtttatgatttctctttctcagtgcacttagaactgttatgattttaagactatgttgtttcccgactcatgcatgact |
414706 |
T |
 |
| Q |
101 |
tgaacacttacttgtggaaatttggtcgtaaatgtgtaagattataacaaagtatttatgcatggtgatttgaatcttcatatgaatgtgccttatacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
414707 |
tgaacacttacttgtggaaatttggtcgtaaatgtgtaagattataacaaagtatttatgcatggtgatttgaatcttcatatgaatgtgccttatacat |
414806 |
T |
 |
| Q |
201 |
ttgctt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
414807 |
ttgctt |
414812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 90 - 206
Target Start/End: Complemental strand, 37211559 - 37211445
Alignment:
| Q |
90 |
catgcatgacttgaacacttacttgtggaaatttggtcgtaaatgtgtaagattataacaaagtatttatgcatggtgatttgaatcttcatatgaatgt |
189 |
Q |
| |
|
||||| ||||||||||| ||||| |||||| |||||| | ||| |||||||||||| | |||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
37211559 |
catgcgtgacttgaacaattactcgtggaa-tttggtggcaaa-gtgtaagattatggcgaagtatttatgcatggtgatttgaatttccatatgaatgt |
37211462 |
T |
 |
| Q |
190 |
gccttatacatttgctt |
206 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
37211461 |
gccttatagatttgctt |
37211445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 134 - 203
Target Start/End: Complemental strand, 37202146 - 37202078
Alignment:
| Q |
134 |
gtgtaagattataacaaagtatttatgcatggtgatttgaatcttcatatgaatgtgccttatacatttg |
203 |
Q |
| |
|
||||||||||||| | |||||||||||||| ||||||||||| | |||||||||| |||||||| ||||| |
|
|
| T |
37202146 |
gtgtaagattatagccaagtatttatgcatagtgatttgaatttccatatgaatg-gccttatagatttg |
37202078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University