View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14411_low_47 (Length: 224)
Name: NF14411_low_47
Description: NF14411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14411_low_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 21 - 206
Target Start/End: Complemental strand, 36239636 - 36239451
Alignment:
| Q |
21 |
aaccctaacagtaacactcctcttgaaggttcaacttctcacacttcaaattcagtttcatcagttgctagatcgcttctcccaacacgacgtcgtctca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36239636 |
aaccctaacagtaacactcctcttgaaggttcaacttctcacacttcaaattcagtttcatctgttgctagatcgcttctcccaacacgacgtcgtctca |
36239537 |
T |
 |
| Q |
121 |
agcttgatccttctaacaaactttacttcccttgtatgtctgctgctcannnnnnnatgtttctgttttactttgcttgcaattta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36239536 |
agcttgatccttctaacaaactttacttcccttgtatgtctgctgctcatttttttatgtttctgttttactttgcttgcaattta |
36239451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University