View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14411_low_48 (Length: 220)
Name: NF14411_low_48
Description: NF14411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14411_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 19 - 128
Target Start/End: Complemental strand, 15952630 - 15952521
Alignment:
| Q |
19 |
tagatctctacaaaatgattaatcttgatcatggcttatttacactttctatgtctttccaacaattttgggttgtagctttgtgaatttcttcaagata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15952630 |
tagatctctacaaaatgattaatcttgatcatggcttatttacactttctatgtctttccaacaattttgggttgtagctttgtgaatttcttcaagata |
15952531 |
T |
 |
| Q |
119 |
aggtaaaccc |
128 |
Q |
| |
|
|||||||||| |
|
|
| T |
15952530 |
aggtaaaccc |
15952521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University