View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14411_low_48 (Length: 220)

Name: NF14411_low_48
Description: NF14411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14411_low_48
NF14411_low_48
[»] chr5 (1 HSPs)
chr5 (19-128)||(15952521-15952630)


Alignment Details
Target: chr5 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 19 - 128
Target Start/End: Complemental strand, 15952630 - 15952521
Alignment:
19 tagatctctacaaaatgattaatcttgatcatggcttatttacactttctatgtctttccaacaattttgggttgtagctttgtgaatttcttcaagata 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15952630 tagatctctacaaaatgattaatcttgatcatggcttatttacactttctatgtctttccaacaattttgggttgtagctttgtgaatttcttcaagata 15952531  T
119 aggtaaaccc 128  Q
    ||||||||||    
15952530 aggtaaaccc 15952521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University