View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14412_high_15 (Length: 238)
Name: NF14412_high_15
Description: NF14412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14412_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 28 - 231
Target Start/End: Original strand, 6191438 - 6191638
Alignment:
| Q |
28 |
cactataaataccctctagttcttttataccaagccttcatgatccaataaaaactccaaaccctagacttgaaacaaggtgagagattaataataatag |
127 |
Q |
| |
|
||||||||||||| |||| ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6191438 |
cactataaataccatctacttcttttatactaagccttcatgatccaataaaaac-ccaaaccctagacttgaaacaaggtgagagattaataataatag |
6191536 |
T |
 |
| Q |
128 |
agaaattttattaannnnnnnngtgagtataagtgattcaaatatggatgtagcagctggtggtggtttcaaaaatgttacatctcccactccttacccc |
227 |
Q |
| |
|
||||| |||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6191537 |
agaaaatttattaattttttttgt--gtataagtgattccaatatggatgtagcagctggtggtggtttcaaaaatgttacatctcccactccttacctc |
6191634 |
T |
 |
| Q |
228 |
tttg |
231 |
Q |
| |
|
|||| |
|
|
| T |
6191635 |
tttg |
6191638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University