View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14412_low_14 (Length: 247)
Name: NF14412_low_14
Description: NF14412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14412_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 13 - 232
Target Start/End: Original strand, 328021 - 328240
Alignment:
| Q |
13 |
aatatatctcgtgaagcacaaacaatggtactagtggaccaccctaacgtgctaaaatcacactgttcattcgtgagtgatcacaatctatgggttgtga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
328021 |
aatatatctcgtgaagcacaaacaatggtactagtggaccaccctaacgtgctaaaatcacactgctcattcgtgagtgatcacaatctatgggttgtga |
328120 |
T |
 |
| Q |
113 |
tgccattcatgtcgggtggttcatgtcttcacatattgaaagctgcacatcctgatgggtttgaagaggttgttattgcaactgtgctcagggaggtatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
328121 |
tgccattcatgtcgggtggttcatgtcttcacatattgaaagctgcacatcctgatggatttgaagaggttgttattgcaactgtgctcagggaggtatt |
328220 |
T |
 |
| Q |
213 |
gaagggtttagagtatcttc |
232 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
328221 |
gaagggtttagagtatcttc |
328240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University