View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14413_high_17 (Length: 232)
Name: NF14413_high_17
Description: NF14413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14413_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 32101857 - 32102071
Alignment:
| Q |
1 |
agacttaaacatcattgctagtcattccaggttatgaggaatacttattgtggtaaatcaaatttgtcttcaagtgcaggcacaatgagattctcttatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32101857 |
agacttaaacatcattgctagtcattccaggttatgaagaatacttattgtggtaaatcgaatttgtcttcaagtgcaggcacaatgagattctcttatt |
32101956 |
T |
 |
| Q |
101 |
ataggttttgttatcatcagtaagttggcagcttggctcaagagcatttctaagttgtagtaagatccttagtattcattgatcctcataacttgctgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32101957 |
ataggttttgttatcatcagtaagttggtagcttggctcaagagcatttctaagttgtagtaagatccttattattcattgatcctcataacttgctgat |
32102056 |
T |
 |
| Q |
201 |
ataactactgttatg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32102057 |
ataactactgttatg |
32102071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 215
Target Start/End: Original strand, 32107433 - 32107509
Alignment:
| Q |
140 |
aagagcatttctaagttgtagtaagatccttagtattcattgatcct-cataacttgctgatataactactgttatg |
215 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||| ||| ||||| || ||||| ||| ||||| || ||||||||| |
|
|
| T |
32107433 |
aagagaatttcttagttgtagtaagatccttagttttccttgatgctgcataatttgttgataaaatgactgttatg |
32107509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University