View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14413_low_18 (Length: 268)
Name: NF14413_low_18
Description: NF14413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14413_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 115 - 246
Target Start/End: Complemental strand, 36373357 - 36373226
Alignment:
| Q |
115 |
catggtgtagacaattaagacctagtttaaatttaatctccactaataaacatcgtgatatattcccaaattagttcatcattgagtttaatatcgagtt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36373357 |
catggtgtagacaattaagacctagtttaaatttaatctccactaataaacatcgtgatttattcccaaattagttcatcattgagtttaatatcgagtt |
36373258 |
T |
|
| Q |
215 |
tnnnnnnncattataaatgagttgatgagctg |
246 |
Q |
| |
|
| ||||||| |||||||||||||||| |
|
|
| T |
36373257 |
taaaaaaacattatacatgagttgatgagctg |
36373226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University