View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14413_low_19 (Length: 250)
Name: NF14413_low_19
Description: NF14413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14413_low_19 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 32101574 - 32101812
Alignment:
| Q |
12 |
atgaaccgaacatatcctttaaaaactgaacatttgaacagctcactaaccgaactggatttatgactacagctcactagactgaaatgctaatgaccac |
111 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32101574 |
atgaacggaacctatcctttaaaaactgaacatttgaacagctcactaaccgaactggatttatgactacagctcactagactgaaatgctaatgaccac |
32101673 |
T |
|
| Q |
112 |
agttcagttaacatctcaaactcaatctgttcgcttgctcattctcactatccgtctaggacccaagaatgaatgatgtgctcttgcttgctcgctacag |
211 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32101674 |
agttcagttaacatctcaaattcaatctgtttgcttgctcattctcactatccgtctaggacccaagaatgaatgatgtgctcttgcttgctcgctacag |
32101773 |
T |
|
| Q |
212 |
tttggttcttgaactcacaaccatcatcttaaaacagta |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32101774 |
tttggttcttgaactcacaaccatcatcttaaaacagta |
32101812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 110 - 164
Target Start/End: Original strand, 32107104 - 32107157
Alignment:
| Q |
110 |
acagttcagttaacatctcaaactcaatctgttcgcttgctcattctcactatcc |
164 |
Q |
| |
|
|||||| |||||||||| |||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
32107104 |
acagttaagttaacatc-caaactcaatttgtttgcttgctcattctcactatcc |
32107157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 92 - 160
Target Start/End: Original strand, 32115806 - 32115873
Alignment:
| Q |
92 |
actgaaatgctaatgaccacagttcagttaacatctcaaactcaatctgttcgcttgctcattctcact |
160 |
Q |
| |
|
||||||||||| ||||| |||||| ||||||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
32115806 |
actgaaatgcttatgactacagttgggttaacatc-caaacgcaatctgtctgcttgctcattctcact |
32115873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University