View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14413_low_20 (Length: 241)
Name: NF14413_low_20
Description: NF14413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14413_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 49 - 192
Target Start/End: Complemental strand, 8518763 - 8518622
Alignment:
| Q |
49 |
agtcttcatcttaataactttctgaggcaaatatcatattctgtactcagccagcttctgtttcataattcatattccaattccttataaaaccatagat |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8518763 |
agtcttcatcttaataactttctgaggcaaatatcatattctg--ctcagccagcttctgtttcataattcatattccaattccttataaaaccatagat |
8518666 |
T |
 |
| Q |
149 |
tatgaaaatggggcataacccatatgtcataattaagaagttct |
192 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8518665 |
tctgaaaatggggcataacccatatgtcataattaagaagttct |
8518622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University