View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14413_low_24 (Length: 208)
Name: NF14413_low_24
Description: NF14413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14413_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 13 - 191
Target Start/End: Original strand, 43610551 - 43610730
Alignment:
| Q |
13 |
aagaatattggtcatgtctt---gtactcatgtttgatannnnnnnnaagtttaaattagaggaaaataattaagaaaaacatnnnnnnnnnnttgtatc |
109 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43610551 |
aagaatattggtcatgtcttcttgtactcatgtttgatattttttt-aagtttaaattagaggaaaataattaagaaaaacataaaaaaaaa-ttgtatc |
43610648 |
T |
|
| Q |
110 |
attagagttgatgattatctatattattatcctaaatgtaacaggggacactagtgactgcagttgcctactacttgcaagc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43610649 |
attagagttgatgattatctatattattatcctaaatgtaacaggggacactagtgactgcagttgcctactacttgcaagc |
43610730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 111 - 191
Target Start/End: Original strand, 43617534 - 43617611
Alignment:
| Q |
111 |
ttagagttgatgattatctatattattatcctaaatgtaacaggggacactagtgactgcagttgcctactacttgcaagc |
191 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
43617534 |
ttagagttgatgattatctatattac---cttaaatgtaacaggggacactagtgactgcagttgcatattacttgcaagc |
43617611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University