View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14414_high_12 (Length: 323)
Name: NF14414_high_12
Description: NF14414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14414_high_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 9 - 80
Target Start/End: Complemental strand, 15303179 - 15303112
Alignment:
| Q |
9 |
agcagagaacaccgttgttgaggtttgaatttgctcgattttggttctttgaattaataagtattttaaata |
80 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15303179 |
agcagaaaacaccgttgttgaggtttgaatttgctcgattttggttctttg----aataagtattttaaata |
15303112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University