View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14414_high_22 (Length: 219)
Name: NF14414_high_22
Description: NF14414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14414_high_22 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 1e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 29718617 - 29718416
Alignment:
| Q |
18 |
atcactcgataattatcacacgcaattgaattgcataaaagccaacgcatatagcaataagcataaagactggaaggacaacaaaacaaaatttaatgcc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29718617 |
atcactcgataattatcacacgcaattgaattgcataaaagccaacgcatatagcaataagcataaagagtggaaggacaacaaaacaaaatttaatgcc |
29718518 |
T |
|
| Q |
118 |
aataatgatggaaaatatattgaatagaacttggaggagaaagcaggtgccacattgaagcagaccggcacacagaatcgcgcttattccaagcacggag |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
29718517 |
aataatgatggaaagtatattgaatagagcttggaggagaaagcaggtgccacattgaagcagactggcacacagaatcgcgcttattccaaacacggag |
29718418 |
T |
|
| Q |
218 |
ca |
219 |
Q |
| |
|
|| |
|
|
| T |
29718417 |
ca |
29718416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University