View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14414_high_23 (Length: 218)
Name: NF14414_high_23
Description: NF14414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14414_high_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 20 - 178
Target Start/End: Complemental strand, 3342842 - 3342687
Alignment:
| Q |
20 |
caattctctttctttgtttatgtattgtgatgagaggttaacgtttgggattcaaatgtttatggattatgtttgtctataggtggttgtgaaatattag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
3342842 |
caattctctttctttgtttatgtattgtgataagaggttaacgtttgggattcaaatgtttatggattatgtttgtctata---ggttgtgaaatagtag |
3342746 |
T |
|
| Q |
120 |
gattgttattgatatggtggatgtgtaagaaaataatgttccaaaacatgtagtataat |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342745 |
gattgttattgatatggtggatgtgtaagaaaataatgttccaaaacatgtagtataat |
3342687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University