View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14414_low_16 (Length: 289)
Name: NF14414_low_16
Description: NF14414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14414_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 14 - 274
Target Start/End: Original strand, 30782845 - 30783112
Alignment:
| Q |
14 |
attattctgtggcagtatgtgatgtgtgtaaaattaagatctaggtaagatatgtatatttaggattcgaacaagttgaaagctttcaacaagtgtatac |
113 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30782845 |
attattttgtggcagtatgtgatgtgtgtaaaattaagatctaggtaagatatgtatatttaggattcgaacaagttgaaagctttcaacaagtgtatac |
30782944 |
T |
|
| Q |
114 |
tttgaattactatgatgtagatatctaatatttccatc-------ttgcttactttcatatgtgtgtgggtcaatgcaannnnnnnnctcaacaagacaa |
206 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30782945 |
tttgaattactatgatgtaggtatctaatatgtccatcttgcttattgcttactttcatatgtgtgtgggtcaatgcaattttttttctcaacaagacaa |
30783044 |
T |
|
| Q |
207 |
tctctatggttatttttgtttctctacattcatttgatgagttatgtagattcttttccttcgagatt |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30783045 |
tctctatggttatttttgtttctctacattcatttgatgagttatgtagattcttttccttcgagatt |
30783112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University