View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14415_high_15 (Length: 241)
Name: NF14415_high_15
Description: NF14415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14415_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 5775580 - 5775360
Alignment:
| Q |
1 |
atgattataatgtgatttgatttgattcaatagttgtctaaacaaaatttacactgttattatttgcataacagttatgattaatttgtttgttttgcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5775580 |
atgattataatgtgatttgatttgattcaataattgtctaaacaaaatttacactgttattatttgcataacagttatgattaatttgtttgttttgcct |
5775481 |
T |
 |
| Q |
101 |
ctatttatacttgggtactgttttttattagagggacttggaagagcgactccacgatggtgttttcggaggatgaaatatcaaagctgtataggatccg |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5775480 |
ctatttatacttgggtactgttttctattagagggacttggaagagcgactccacaatggtgttttcggaggatgaaatatcaaagctgtataggatccg |
5775381 |
T |
 |
| Q |
201 |
gaagaaggtgatggagatgct |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5775380 |
gaagaaggtgatggagatgct |
5775360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 5768927 - 5768705
Alignment:
| Q |
1 |
atgattataatgtgatttgatttgattcaatagttgtctaaacaaaatttacactgttattatttgcataacagttatgattaatttgtttgttttgcct |
100 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5768927 |
atgattataatatgatttgatttaattctgtagttgtctaaacaaaatttacactgttattatttgcataacagttatgattaatttgtttattttgcct |
5768828 |
T |
 |
| Q |
101 |
ctatttatacttgggtactgttttt--tattagagggacttggaagagcgactccacgatggtgttttcggaggatgaaatatcaaagctgtataggatc |
198 |
Q |
| |
|
|| |||||||||| || |||||||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5768827 |
ctgtttatacttgagttctgtttttcctattagagggacttagaagagcgactccacaatggtgttttcggaggatgaaatatctaagctgtataggatc |
5768728 |
T |
 |
| Q |
199 |
cggaagaaggtgatggagatgct |
221 |
Q |
| |
|
||||||| ||||||||||||||| |
|
|
| T |
5768727 |
cggaagacggtgatggagatgct |
5768705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 160 - 221
Target Start/End: Complemental strand, 5775046 - 5774985
Alignment:
| Q |
160 |
gtgttttcggaggatgaaatatcaaagctgtataggatccggaagaaggtgatggagatgct |
221 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5775046 |
gtgttttcggaggatgaaatatcgaagctgtataggatccggaagacggtgatggagatgct |
5774985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University