View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14415_high_7 (Length: 340)
Name: NF14415_high_7
Description: NF14415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14415_high_7 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 326
Target Start/End: Complemental strand, 303931 - 303609
Alignment:
| Q |
18 |
atatcgatatacacaatacaacacaccttgagtatttggaattaaggattgttttttgaccatactttctccattcatgcccatcatctgttggtctttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303931 |
atatcgatatacacaatacaacacaccttgagtatttggaattaaggattgttttttgaccatactttctccattcatgcccatcatctgttggtctttc |
303832 |
T |
|
| Q |
118 |
tgacacttcctcacacgtttctctagtttttctgcaaattaacnnnnnnn--------------tgttcatattcctagctagcaaacaattaacatgat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
303831 |
tgacacttcctcacacgtttctctagtttttctgcaaattaaccatgatcaataaataaaaaaatgttcatattcctagctagcaaacaattaacatgat |
303732 |
T |
|
| Q |
204 |
tgtttttaatgattagtaccttcttttgtgagatcctctagcaccaggggtggaattagtcttgcaactatcttgagagtcctcttcagatttaatggtt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
303731 |
tgtttttaatgattagtaccttcttttgtgagatcctctagcaccaggggtggaattagtcttgcaactatcttgagagtcctcttcagatttaatggtt |
303632 |
T |
|
| Q |
304 |
aaggaaaagtcttgttccctttg |
326 |
Q |
| |
|
|||||||||| |||||||||||| |
|
|
| T |
303631 |
aaggaaaagttttgttccctttg |
303609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 77 - 153
Target Start/End: Complemental strand, 478778 - 478702
Alignment:
| Q |
77 |
ccatactttctccattcatgcccatcatctgttggtctttctgacacttcctcacacgtttctctagtttttctgca |
153 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||| |||||| ||| | ||| || |||| | ||||| ||||||| |
|
|
| T |
478778 |
ccatactgtctccattgatgcccatcatctgttggagtttctgtcaccttctcccatgtttgtgtagttcttctgca |
478702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University