View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14415_low_16 (Length: 258)
Name: NF14415_low_16
Description: NF14415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14415_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 6638197 - 6638427
Alignment:
| Q |
11 |
gtgagatgaaattaattgaagcatgattgcaacacaaagattttttgttacggttagttggcttttcccatttctgaaataccattcgttgatctagcgg |
110 |
Q |
| |
|
|||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6638197 |
gtgaaatgaaattaaacgaagtatgattgcaacacaaagattttttgttacggttagttggcttttcccatttctgaaataccattcgttgatctagcgg |
6638296 |
T |
 |
| Q |
111 |
ccatatcctttattttattctgaagtcattctcttctgccatacaccatgccaccttatcttctctttctctctatactctccatctccaaccaagtggg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6638297 |
ccatatcctttattttattctgaagtcattctcttctgccatacaccatgccaccttatcttctctttctctctctactctccatctccaaccaagtggg |
6638396 |
T |
 |
| Q |
211 |
catatactattatccattattagatcttttt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6638397 |
catatactattatccattattagatcttttt |
6638427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University