View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14415_low_18 (Length: 237)
Name: NF14415_low_18
Description: NF14415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14415_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 5173757 - 5173900
Alignment:
| Q |
1 |
ttgactattaacattgcaaaaactattcccgactctgtcaatcgttataattgaggggttacgaggttgttgttgaacttagaatgatattgttgaactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5173757 |
ttgactattaacattgcaaaaactattcccgactctgtcaaacgttataattgaggggttacgaggttgttgttgaacttagaatgatgttgttgaactt |
5173856 |
T |
|
| Q |
101 |
tgaaggggttgcagttgaacttaaaatgctaaggttttatgtca |
144 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5173857 |
tgaaggggtcgcagttgaacttaaaatgctaaggttttatgtca |
5173900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 141 - 221
Target Start/End: Original strand, 5173972 - 5174051
Alignment:
| Q |
141 |
gtcaaattaaaaagtagtattttggagcttaaggtgaatttatcattgttttccaatttctgactcttttattattcattg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5173972 |
gtcaaattaaaaagtagtattttggagcttaaggtgaatttatca-tgttttccaatttctgactcttttattattcattg |
5174051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University