View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14415_low_20 (Length: 225)
Name: NF14415_low_20
Description: NF14415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14415_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 27 - 209
Target Start/End: Original strand, 52885538 - 52885720
Alignment:
| Q |
27 |
tcagagagccagttagaatcgtgtgatgaatatcttataatgatatgtcaatttttgtctccaaagaacatgtccaattaaggctttcatcctaaaagac |
126 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52885538 |
tcagagagccaattaagatcgtgtgatgaatatcttataatgatatgtcaatatttgtctccaaagaacatgtccaattaaggctttcatcctaaaagac |
52885637 |
T |
|
| Q |
127 |
caactcatgactcaagtgcatcttctctaaacttaaaacttaaggctcgcattttatcactgacttaaccattgtaatgtttg |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52885638 |
caactcatgactcaagtacatcttctctaaacttaaaacttaagactcgcattttatcactgacttaaccattgtaatgtttg |
52885720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University