View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14415_low_21 (Length: 209)
Name: NF14415_low_21
Description: NF14415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14415_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 33950553 - 33950366
Alignment:
| Q |
1 |
ttcttctgtttttgcctgtctgtgttctttagaaatgaaagtttagaataattgttgtagtagaatgttttgaaattgaaactttggatatgtgatacaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33950553 |
ttcttctgtttttgcctgtctgtgttctttagaaatgaaagtttagaataattgttgtagtagaatgttttgaaattgaaactttgg--atgtgatacaa |
33950456 |
T |
 |
| Q |
101 |
accctatttatagtagtagtatcaagaatggaatggtaccgtgttcttctttgtctctttccggcacattacgtactaatcttcgttattctt |
193 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33950455 |
accctattta---tagtagtatcaagaatggaatggtaccgtgttcttttttatctctttccggcacattacgtactaatcttcgttattctt |
33950366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 124 - 193
Target Start/End: Original strand, 8279043 - 8279111
Alignment:
| Q |
124 |
aagaatggaatggtaccgtgttcttctttgtctctttccggcacattacgtactaatcttcgttattctt |
193 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8279043 |
aagaaaggaatggtaccgtgttcttcttc-tctctttccggcacattgcgtactaatcttcgttattctt |
8279111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University