View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14417_high_10 (Length: 327)
Name: NF14417_high_10
Description: NF14417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14417_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 6e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 117 - 311
Target Start/End: Complemental strand, 36980461 - 36980267
Alignment:
| Q |
117 |
caatttaaatttatctctctccaaatacattagctgaattcgaatttgcaaccttcattttagcactaataaatcaattttgtttttccttcacgtagat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36980461 |
caatttaaatttatctctctccaaatacatcagctgaattcgaatttgcaaccttcattttagcactaataaatcaattttgtttttccttcacgtagat |
36980362 |
T |
 |
| Q |
217 |
cgagggtgctgggaataatgtgtttaacctgtgtccactctacggtaaggtccctaactctgtaaaggcaataatagtgttatggatgaaagata |
311 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36980361 |
cgagggtgctgggaataatttgtttaatctgtgtccactctacggtaaggtccctaactctgtaaaggcaataatagtgttatggatgaaagata |
36980267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 36980577 - 36980531
Alignment:
| Q |
1 |
tccgtttatggtaaaacaatgggggcgagggaatgcagttccaatcc |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36980577 |
tccgtttatggtaaaacaatgggggcgagggaatgcagttccaatcc |
36980531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University