View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14417_high_12 (Length: 290)
Name: NF14417_high_12
Description: NF14417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14417_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 32271864 - 32272136
Alignment:
| Q |
1 |
acaaggttgaattttgaagtatctttcttagcatcaaaattaccaaacccttcagcaacaatgtagaaatcatacccaagaaggtgaagtgggtgattct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| ||||||||||| |
|
|
| T |
32271864 |
acaaggttgaattttgaagtatctttcttagcatcaaaattaccaaacccttcagcaacaatgtaaaaatcatacccatgaaggtgaattgggtgattct |
32271963 |
T |
|
| Q |
101 |
caggagtaacaatactggtatcttgcaacacaatttgcacccttgatccaaacttcaacttgtaagctttagtcccgggaacaggttgccagagggaacg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32271964 |
caggagtaacaatactggtatcttgcaacacaatttgcacccttgatccaaacttcaacttgtaagctttagtcccgggaacaggttgccagagggaacg |
32272063 |
T |
|
| Q |
201 |
gctcacgttgccggtgtaatcgaatttaacgggtggttttgctggaaaatcagtggtaaaaaccccagggatt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32272064 |
gctcacgttgccggtgtaatcgaatttaacgggtggttttgctggaaaatcagtggtaaaaactccagggatt |
32272136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 35991074 - 35991336
Alignment:
| Q |
1 |
acaaggttgaattttgaagtatctttcttagcatcaaaattaccaaacccttcagcaacaatgtagaaatcatacccaagaaggtgaagtgggtgattct |
100 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| |||||||| ||||| || || |||||||| ||||||||||| ||| |||| |||| |||||||||| |
|
|
| T |
35991074 |
acaaggttaaattttgaagcatctttcttagggtcaaaatttccaaatccctcggcaacaatatagaaatcatatccatgaagatgaatagggtgattct |
35991173 |
T |
|
| Q |
101 |
caggagtaacaatactggtatcttgcaacacaatttgcacccttgatccaaacttcaactt-gtaagctttagtcccgggaacaggttgccagagggaac |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||| || |||||||||||||| ||||||| |||| |||||||||| ||| |||||||| | || | |
|
|
| T |
35991174 |
caggagtaacaatactagtatcttgcaaaacaacctgaacccttgatccaaatctcaacttagtaa-ctttagtcccttgaatcggttgccacaacgacc |
35991272 |
T |
|
| Q |
200 |
ggctcacgttgccggtgtaatcgaatttaacgggtggttttgctggaaaatcagtggtaaaaac |
263 |
Q |
| |
|
| ||||| || ||||||||||| |||| ||||| ||||||| |||||||| || |||||||| |
|
|
| T |
35991273 |
gactcacattaccggtgtaatcaaattgcacgggaggttttgtgggaaaatccgtcgtaaaaac |
35991336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University