View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14417_high_18 (Length: 221)
Name: NF14417_high_18
Description: NF14417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14417_high_18 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 28256915 - 28257135
Alignment:
| Q |
1 |
aatattattgtttgaatgatggaattaatttcaacatgctggacaagtgaaaatgactgacaaaccttctttaacagcggttgctatcttaatatttaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28256915 |
aatattattgtttgaatgatggaattaatttcaacatgctggacaagtgaaaatgactgacaaaccttctttaacagcggttgctatcttaatatttaat |
28257014 |
T |
|
| Q |
101 |
ttgtcataaattcaacaaatttcaaaattttgtagagtattggaggaaatatgttgcatgtgtcagaggaccatatctagagcaaatcgagtgatattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28257015 |
ttgtcataaattcaacaaatttcaaaattttgtagagtattggaggaaatatgttgcatgtgtcagaggaccatatctagagcaaatcgagtgatattaa |
28257114 |
T |
|
| Q |
201 |
ggccaactgaaagctagcagt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
28257115 |
ggccaactgaaagctagcagt |
28257135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University