View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14417_high_19 (Length: 215)
Name: NF14417_high_19
Description: NF14417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14417_high_19 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 19 - 215
Target Start/End: Original strand, 6432261 - 6432456
Alignment:
| Q |
19 |
atgatgatgatgaatttgactggcctgatctgccagcaacaccgagatctttttgggaggtttacaacgtaagaagtggctcttggaagaaacttgatta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6432261 |
atgatgatgatgaatttgactggcctgatctgccagcaacaccgagatctttttgggaggtttacaacgtaagaagtggctcttggaagaaacttgatta |
6432360 |
T |
 |
| Q |
119 |
tgatatggatattcccagaggtgtaagacgtaatgtgtacttggatggggtgtgtcattggtttgcagatgatgaaaaatatatggtttcgtttaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6432361 |
tgatatggatattcccagaggtgtaagacgtaatgtgtacttggatggggtgtgtcattggtttgcagat-atgaaaaatatatggtttcgtttaac |
6432456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University