View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14417_low_11 (Length: 299)
Name: NF14417_low_11
Description: NF14417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14417_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 105 - 290
Target Start/End: Complemental strand, 34731784 - 34731603
Alignment:
| Q |
105 |
tatcctcaaaacaagtttgagatctcttttatctgcgtttgnnnnnnnnnnnnnntgttcttgccattttatagctactttcgtgaagggttgagctaat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34731784 |
tatcctcaaaacaagtttgagatctcttttatctgcgtttggtgtgtgtgt----tgttcttgccattttatagctactttcatgaagggttgagctaat |
34731689 |
T |
 |
| Q |
205 |
aaaagcattgaaatggagaatttgattggaacaagattgtatttttgctttaattgtagaaaccatgttgccgttcatgatgatgt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34731688 |
aaaagcattgaaatggagaatttgattggaacaagattgtatttttgctttaattgtagaaaccatgttgccgttcatgatgatgt |
34731603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University