View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14417_low_9 (Length: 331)
Name: NF14417_low_9
Description: NF14417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14417_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 31719828 - 31720044
Alignment:
| Q |
1 |
aatatagacgtttaattgctgctattcatgctgggaagcctaaagattgaatagaggaatgtctcaaagtggaacctgataaagtgagatgtctaagttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31719828 |
aatatagacgtttaattgctgctattcatgctgggaagcctaaagattgaatagaggaatgtctcaaagtggaacctgataaagtgagatgtctaagttt |
31719927 |
T |
 |
| Q |
101 |
aagtcccacaccgttcaatagtgttgtaaatatccctagatctattataaaggttaaattccttcagtacattaacaatgcctttctcggccctattcgt |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31719928 |
aagtcccacaccgttcaacagtgttgtaaatatccatagatctattataaaggttaaattccttcagtacattaacaatgcctttctcggccctattcgt |
31720027 |
T |
 |
| Q |
201 |
tgggttgcaaaagggat |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
31720028 |
tgggttgcaaaagggat |
31720044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 20 - 104
Target Start/End: Complemental strand, 31011773 - 31011689
Alignment:
| Q |
20 |
tgctattcatgctgggaagcctaaagattgaatagaggaatgtctcaaagtggaacctgataaagtgagatgtctaagtttaagt |
104 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||| |||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
31011773 |
tgctattcatgctgggaagcctaaaggtggaatagtggaatgtctcaaagtggagcctgataaagtgagacgtctaagtttaagt |
31011689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 20 - 104
Target Start/End: Original strand, 31709549 - 31709633
Alignment:
| Q |
20 |
tgctattcatgctgggaagcctaaagattgaatagaggaatgtctcaaagtggaacctgataaagtgagatgtctaagtttaagt |
104 |
Q |
| |
|
|||||| ||||||||||||||||||| | |||||| |||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
31709549 |
tgctatacatgctgggaagcctaaaggtggaatagtggaatgtctcaaagtggagcctgataaagtgagacgtctaagtttaagt |
31709633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 253 - 320
Target Start/End: Original strand, 31720079 - 31720146
Alignment:
| Q |
253 |
taaatgtgtagataatgatatagatcttttttgtcaaccctaatatatataagaaaattgttcattca |
320 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31720079 |
taaatgtgtggataatgatatagatcttttttgtcaacccaaatatatataagaaaattgttcattca |
31720146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 102 - 167
Target Start/End: Original strand, 31712018 - 31712084
Alignment:
| Q |
102 |
agtcccacaccgttcaatagtgttgtaaatatcc-ctagatctattataaaggttaaattccttcag |
167 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
31712018 |
agtcccacaccgttcaatagtgtagtaagtatccaagagatctattataaaggttaaactccttcag |
31712084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 252 - 288
Target Start/End: Original strand, 31719433 - 31719469
Alignment:
| Q |
252 |
ttaaatgtgtagataatgatatagatcttttttgtca |
288 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
31719433 |
ttaaatgtgtggataatgatatagattttttttgtca |
31719469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University