View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14418_high_12 (Length: 345)
Name: NF14418_high_12
Description: NF14418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14418_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 230 - 327
Target Start/End: Complemental strand, 42156307 - 42156211
Alignment:
| Q |
230 |
taaataagatgataaatttatccatcttcacttactcaagcgggccaaattacacaatttcaattttatttttactcctaatcctccttcctcctttg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
42156307 |
taaataagatgataaatttatccatcttcacttactcaagcgggacaaattacacaatttcaatttt-tttttactcctaatcctccttcatcctttg |
42156211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University