View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14418_low_12 (Length: 359)
Name: NF14418_low_12
Description: NF14418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14418_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 1 - 344
Target Start/End: Complemental strand, 6123423 - 6123078
Alignment:
| Q |
1 |
ttttgactaaagtttcaatttagttcttaaactataagattctctcctatttgatccattattaacgatttagatataatgtagatcttgatatttaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6123423 |
ttttgactaaagtttcaatttagttcttaaactataagattctctcctatttgatccattattaacgatttagatataatgtagatcttgatatttaaaa |
6123324 |
T |
 |
| Q |
101 |
gcagaaacgctaaacttaatttgataccgatgttgtgattgcgtgaatttataaa--gtactgactgcagaaaatcaaaatccgagaaagagcatatagt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6123323 |
gcagaaacgctaaacttaatttgataccaatgttgtgattgcgtgaatttataaattgtactgactgcagaaaatcaaaatccgagaaagagcatatagt |
6123224 |
T |
 |
| Q |
199 |
aatttacctatagtggcgagagtcccgtgcggatatagcagcaacctccacaagagcagctttccacttggacacttttccgggatttgtgagatcatca |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6123223 |
aatttacctatagtggcgagagtcccgtgcggatatagcagcaacctccacaagagcagctttccacttggacacttttccgggattcgtgagatcatca |
6123124 |
T |
 |
| Q |
299 |
cattgattgttcatgagctctctctcatatcttgcaaatgctttct |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6123123 |
cattgattgttcatgagctctctctcatatcttgcaaatgctttct |
6123078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University