View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14418_low_16 (Length: 327)
Name: NF14418_low_16
Description: NF14418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14418_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 27 - 311
Target Start/End: Original strand, 50453161 - 50453445
Alignment:
| Q |
27 |
tagcataaaatggacggtacaaaccaggatatgactcggtgcttatccacaactcgtgtgtctagaaaatgatactacacgacaatgaccattttcaatt |
126 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50453161 |
tagcataaaatgaacggtacaaaccaggatatgactcggtgcttatccacaactcttgtgtctagaaaatgatactacacgacaatgaccattttcaatt |
50453260 |
T |
 |
| Q |
127 |
tttcaccaatttcaatggaatggtttagtttctccttcgggatgccctggtaaacatatctttgatgttatgtgattctgtctccactttcatcttcttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50453261 |
tttcaccaatttcaatggaatggtttagtttctccttcgggatgccctggtaaacatatctttgatgttatgtgattctgtctccactttcatcttcttt |
50453360 |
T |
 |
| Q |
227 |
gcttgtctacccttcttcacaattgtaggcttcttatcatcactctgttcctgataacattagcacttgatttcagcaaacaatt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50453361 |
gcttgtctacccttcttcacaattgtaggcttcttatcatcactctgttcctgataacattagcacttgatttcagcaaacaatt |
50453445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University