View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14419_high_23 (Length: 239)
Name: NF14419_high_23
Description: NF14419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14419_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 11592436 - 11592281
Alignment:
| Q |
1 |
tattggttgctttgttgggtcatgtttttggacatggaatgagaaacaataatggtggtggtgttatgcaaacttggaaccttttggcttctcttttgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11592436 |
tattggttgctttgttgggtcatgtttttggacatggaatgagaaacaataatggtggtggtgttatgcaatcttggaaccttttggcttctcttttgac |
11592337 |
T |
|
| Q |
101 |
tgtttttgttaactctgtttacttggagcctagggccactaaggtatgttctagct |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11592336 |
tgtttttgttaactctgtttacttggagcctagggccactaaggtatgttctagct |
11592281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 11645683 - 11645838
Alignment:
| Q |
1 |
tattggttgctttgttgggtcatgtttttggacatggaatgagaaacaataatggtggtggtgttatgcaaacttggaaccttttggcttctcttttgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11645683 |
tattggttgctttgttgggtcatgtttttggacatggaatgagaaacaataatggtggtggtgttatgcaatcttggaaccttttggcttctcttttgac |
11645782 |
T |
|
| Q |
101 |
tgtttttgttaactctgtttacttggagcctagggccactaaggtatgttctagct |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11645783 |
tgtttttgttaactctgtttacttggagcctagggccactaaggtatgttctagct |
11645838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University