View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14419_low_17 (Length: 361)
Name: NF14419_low_17
Description: NF14419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14419_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 158 - 345
Target Start/End: Complemental strand, 2280430 - 2280244
Alignment:
| Q |
158 |
catagtcgaaaccatagttgtcttcttgaaattaatcagtaatccccaacaacgacgccaaaaacttgatatttgatgtcgcaagtgtactatactctta |
257 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2280430 |
catagtcgaaaccatagttgtcttgttgaaattaatcagtaatccccaacaacgacgccaaaaacttgatgtttgatgtcgcaagtgtactatactctta |
2280331 |
T |
|
| Q |
258 |
tcaagtaaaaataacaatacannnnnnnnnnnaagagaataacaatacatttgttttcacatggattgtgaaatttatacttaacaat |
345 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2280330 |
tcaagtaaaaataataataca-ttttttttttaagagaataacaatacatttgttttcacatggattgtgaaatttatacttaacaat |
2280244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 53 - 93
Target Start/End: Complemental strand, 2280532 - 2280492
Alignment:
| Q |
53 |
aaaagcaataagaacttgctccttttttgtcttcagatttt |
93 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2280532 |
aaaagcaataagaatttgctccttttttgtcttcagatttt |
2280492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University