View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14419_low_31 (Length: 223)
Name: NF14419_low_31
Description: NF14419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14419_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 205
Target Start/End: Original strand, 45459137 - 45459325
Alignment:
| Q |
17 |
aatattcaaaatgtgtgtgtcatgttcttcattgacaatgatgttcttaattttactaataataatgttgtttcccttatctataacctgttttgacata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459137 |
aatattcaaaatgtgtgtgtcatgttcttcattgacaatgatgttcttaattttactaataataatgttgtttcccttatctataacctgttttgacata |
45459236 |
T |
 |
| Q |
117 |
acaaaaatattgtcccagtaccctgcatacagcagttacagcaactacctcacccaaacccaactagcaaccgaaataaactcgagaca |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45459237 |
acaaaaatattgtcccagtaccctgcatacagcagttacagcaactacctcacccaaacccaactagcaaccgaaataaactcgagaca |
45459325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University