View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14419_low_32 (Length: 207)
Name: NF14419_low_32
Description: NF14419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14419_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 190
Target Start/End: Complemental strand, 5531538 - 5531364
Alignment:
| Q |
16 |
agggctaattgaacccatacgagaatcccccacaactgtataaaaacacatcaacacttcaactacaacttcattagttcaaacaaacactaattaatcc |
115 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5531538 |
agggctaattgaacccatacaagaatcacccacaactgtataaaaacacatcaacacttcaactacaacttcattagttcaaacaaacactaattaatcc |
5531439 |
T |
|
| Q |
116 |
atcaccacattgaatcaacaaatccccaaatttcaaaacaagtcagaaaacacatcaacacaacccattacaaaa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5531438 |
atcaccacattgaatcaacaaatccccaaatttcaaaacaagtcagaaaacacatcaacacaacccattacaaaa |
5531364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 143 - 180
Target Start/End: Complemental strand, 5531276 - 5531239
Alignment:
| Q |
143 |
aaatttcaaaacaagtcagaaaacacatcaacacaacc |
180 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5531276 |
aaatttcaaaacaagttagaaaacacatcaacacaacc |
5531239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University