View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441A-Insertion-28 (Length: 440)
Name: NF1441A-Insertion-28
Description: NF1441A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441A-Insertion-28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 5 - 84
Target Start/End: Original strand, 22342922 - 22343000
Alignment:
| Q |
5 |
acatgaatgtattcttacattggtttggtcatagagtgttatataaaaaataacaatgtacttcataactatagctactt |
84 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22342922 |
acatgaatgtattcttacattg-tttggtcatagagtgttatataaaaaataacaatgtacttcataactatagctactt |
22343000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University