View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441A-Insertion-29 (Length: 344)
Name: NF1441A-Insertion-29
Description: NF1441A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441A-Insertion-29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 7 - 279
Target Start/End: Original strand, 116515 - 116787
Alignment:
| Q |
7 |
ataaacatagtgcatatttgattttgctcaaataaatattgattttactcaaatgtgacataggttcaacaataaatttcactgcaagaatcacatttag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116515 |
ataaacatagtgcatatttgattttgctcaaataaatattgattttactcaaatgtgacataggttcaacaataaatttcactgcaagaatcacatttag |
116614 |
T |
|
| Q |
107 |
acttgaaaactacaaataccaatttaaaggtaaaataaattccgaagacaaaatcaaatttatttgaaaataacccaacatatcaaaatcgattttacac |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
116615 |
acttgaaaactacaaataccaatttaaaggtaaaataaattccgaagacaaaatcaaatttatttgaaaataacccaacatatcaaaatcgattttacac |
116714 |
T |
|
| Q |
207 |
acagactcaattatttggctgctcgcaagagtggaaccaaacatagccatagtgtgtccaaacttccaatcca |
279 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
116715 |
acagactcgattatttggctgctcgcaagagtggaaccaaacatagccatagtgtgtccagacttccaatcca |
116787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University