View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441A-Insertion-34 (Length: 136)
Name: NF1441A-Insertion-34
Description: NF1441A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441A-Insertion-34 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 5e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 5e-63
Query Start/End: Original strand, 7 - 136
Target Start/End: Complemental strand, 47339293 - 47339164
Alignment:
| Q |
7 |
atgaaaatggagaactttgagcttctttgtggaaggaatcaactcagaaactgcttgagcagcttcttctgaaattccatcattcataagataaagctcc |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47339293 |
atgaaaatggagaactttgagcttctctgtggaaggaatcaactcagaaactgcttgagcagcttcttctgaaattccatcattcataagataaagctcc |
47339194 |
T |
|
| Q |
107 |
tccaagcagctttgtgatttcaagagagtt |
136 |
Q |
| |
|
||||| |||||||||||||||||||||||| |
|
|
| T |
47339193 |
tccaaacagctttgtgatttcaagagagtt |
47339164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 112
Target Start/End: Complemental strand, 32061802 - 32061701
Alignment:
| Q |
11 |
aaatggagaactttgagcttctttgtggaaggaatcaactcagaaactgcttgagcagcttcttctgaaattccatcattcataagataaagctcctcca |
110 |
Q |
| |
|
||||| ||||| || ||||||| |||||||| ||||| |||| |||||||| |||||||| ||||| || ||||||||||| | |||||||||||||| |
|
|
| T |
32061802 |
aaatgaagaaccttaagcttctcagtggaagggatcaattcagcaactgcttttgcagcttcctctgatataccatcattcatcaaataaagctcctcca |
32061703 |
T |
|
| Q |
111 |
ag |
112 |
Q |
| |
|
|| |
|
|
| T |
32061702 |
ag |
32061701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University