View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441A-Insertion-35 (Length: 128)
Name: NF1441A-Insertion-35
Description: NF1441A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441A-Insertion-35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 8 - 123
Target Start/End: Complemental strand, 3899048 - 3898933
Alignment:
| Q |
8 |
cttcccagccacgacattcttggccgcgtccaatgctccttccaccgcctcctttgcctgatctcctgcattcttcagagcctctgtcgctgacccagca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3899048 |
cttcccagccacgacattcttggccgcgtccaatgctccttccaccgcctcctttgcctgatctcctgcattcttcagagcctctgtcgctgacccagca |
3898949 |
T |
|
| Q |
108 |
gcctcctgtgtgttct |
123 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3898948 |
gcctcctgtgtgttct |
3898933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University