View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441A-Insertion-36 (Length: 112)
Name: NF1441A-Insertion-36
Description: NF1441A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441A-Insertion-36 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 1e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 1e-50
Query Start/End: Original strand, 8 - 112
Target Start/End: Complemental strand, 29285309 - 29285205
Alignment:
| Q |
8 |
aaaacggaaacaccaaaaaacttatgaatagtgctgcattatgtaagttcaacatctccaatgacaggaatattttcaaattacccccttgtaaaaacta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29285309 |
aaaacggaaacaccaaaaaacttatgaatagtgctgcattatataagttcaacatctccaatgacaggaatattttcaaattacccccttgtaaaaacta |
29285210 |
T |
 |
| Q |
108 |
aaaac |
112 |
Q |
| |
|
||||| |
|
|
| T |
29285209 |
aaaac |
29285205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 8 - 111
Target Start/End: Complemental strand, 35233214 - 35233111
Alignment:
| Q |
8 |
aaaacggaaacaccaaaaaacttatgaatagtgctgcattatgtaagttcaacatctccaatgacaggaatattttcaaattacccccttgtaaaaacta |
107 |
Q |
| |
|
||||||||| |||||| ||| ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35233214 |
aaaacggaagcaccaacaaatttatgaaacgcgctgcattatgtaagttcaacatctccaatgacaggaatattttcaaattacccccttgtaaaaacaa |
35233115 |
T |
 |
| Q |
108 |
aaaa |
111 |
Q |
| |
|
|||| |
|
|
| T |
35233114 |
aaaa |
35233111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University