View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441A-Insertion-8 (Length: 864)
Name: NF1441A-Insertion-8
Description: NF1441A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441A-Insertion-8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 6e-92
Query Start/End: Original strand, 185 - 356
Target Start/End: Complemental strand, 1386441 - 1386270
Alignment:
| Q |
185 |
gccattaataatcttttatgtcactttgttaggtaattttggctcttccagtacatggatggtattcatggtgttgattcggggatgcaggtcagtgatg |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1386441 |
gccattaataatcttttatgtcactttgttaggtaattttggctcttccagtacatggatggtattcatggtgttgattcggggatgcaggtcagtgatg |
1386342 |
T |
|
| Q |
285 |
gacaacatcctatacatatgccatatgaacatcatgggttgcaccatatgagcaatgggaatgagatggatg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1386341 |
gacaacatcctatacatatgccatatgaacatcatgggttgcaccatatgagcaatgggaatgagatggatg |
1386270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 625 - 731
Target Start/End: Complemental strand, 26128750 - 26128643
Alignment:
| Q |
625 |
tcattttaaatttctaacaag-agatgaaagactcatgtagtgaataactgggatagaaaaaagatggaagataagctagacataattcattttcagaaa |
723 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||||| ||| || || |||||| ||||| |||||| |||||||| | ||| |||||| ||||| |
|
|
| T |
26128750 |
tcattttaaattgttaacaagtagatgaaagacttgtgtagggaacaattgtgatagagaaaaggtggaaggaaagctagaaagaatgcatttttagaaa |
26128651 |
T |
|
| Q |
724 |
taatgaaa |
731 |
Q |
| |
|
||||||| |
|
|
| T |
26128650 |
caatgaaa |
26128643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University