View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1441R-Insertion-21 (Length: 84)

Name: NF1441R-Insertion-21
Description: NF1441R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1441R-Insertion-21
NF1441R-Insertion-21
[»] chr6 (1 HSPs)
chr6 (8-84)||(15652149-15652225)
[»] chr4 (1 HSPs)
chr4 (8-84)||(612432-612508)


Alignment Details
Target: chr6 (Bit Score: 69; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 15652225 - 15652149
Alignment:
8 aaagataacaaaaatggtgtcaaacaaccttattatctattataactatttccaatgagtgatacagtttgtccttg 84  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||    
15652225 aaagataacaaaaatggtgtcaaacaaccttattatctattataactatttccaatgagtgagagagtttgtccttg 15652149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 61; Significance: 8e-27; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 61; E-Value: 8e-27
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 612508 - 612432
Alignment:
8 aaagataacaaaaatggtgtcaaacaaccttattatctattataactatttccaatgagtgatacagtttgtccttg 84  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||||| ||||||    
612508 aaagataacaaaaatggtgtcaaacaactttattatctattataactatttgcaatgagtgagacagtttttccttg 612432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University