View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441R-Insertion-21 (Length: 84)
Name: NF1441R-Insertion-21
Description: NF1441R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441R-Insertion-21 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 69; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 1e-31
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 15652225 - 15652149
Alignment:
| Q |
8 |
aaagataacaaaaatggtgtcaaacaaccttattatctattataactatttccaatgagtgatacagtttgtccttg |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
15652225 |
aaagataacaaaaatggtgtcaaacaaccttattatctattataactatttccaatgagtgagagagtttgtccttg |
15652149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 61; Significance: 8e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 8e-27
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 612508 - 612432
Alignment:
| Q |
8 |
aaagataacaaaaatggtgtcaaacaaccttattatctattataactatttccaatgagtgatacagtttgtccttg |
84 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
612508 |
aaagataacaaaaatggtgtcaaacaactttattatctattataactatttgcaatgagtgagacagtttttccttg |
612432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University