View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441R-Insertion-25 (Length: 58)
Name: NF1441R-Insertion-25
Description: NF1441R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441R-Insertion-25 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 46; Significance: 4e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 4e-18
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 33190987 - 33191036
Alignment:
| Q |
9 |
catgatgcacctattgtcactcctcttgaggatgttgtattagctcccgt |
58 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33190987 |
catgatgcacctattgtcactcctctagaggatgttgtattagctcccgt |
33191036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.0000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 9 - 45
Target Start/End: Original strand, 39332038 - 39332074
Alignment:
| Q |
9 |
catgatgcacctattgtcactcctcttgaggatgttg |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39332038 |
catgatgcacctattgtcactcctcttgagaatgttg |
39332074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 54
Target Start/End: Original strand, 15187789 - 15187834
Alignment:
| Q |
9 |
catgatgcacctattgtcactcctcttgaggatgttgtattagctc |
54 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| ||||||| |
|
|
| T |
15187789 |
catgatgcacctattgtcacttctctcgaggatgttgatttagctc |
15187834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University