View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_108 (Length: 245)
Name: NF1441_high_108
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_108 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 227
Target Start/End: Original strand, 15096376 - 15096586
Alignment:
| Q |
15 |
catcatcatagttaacaacttttactggttaacattattgatcgaataattaacaggagataaccaaaatgaaatactcataacatcacatagtactatc |
114 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||| ||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15096376 |
catcatcatagttaacaacttttagtggtgaacattattgaccgaataattaacatgagataaccaaaatga--tactcataacatcacatagtactatc |
15096473 |
T |
|
| Q |
115 |
gaaagcgacatgcaattgcaaagtgaggaccatttaagatgtttactaccaaataaaacgttgtaatgtgtgacatgacatgttttctttgcatactgta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15096474 |
gaaagcgacatgcaattgcaaagtgaggactatttaagatgtttactaccaaataaaacgttgtaatgtgtgacatgacatgtttcctttgcatactgta |
15096573 |
T |
|
| Q |
215 |
gttgtagtgttac |
227 |
Q |
| |
|
||||||||||||| |
|
|
| T |
15096574 |
gttgtagtgttac |
15096586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University