View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1441_high_119 (Length: 239)
Name: NF1441_high_119
Description: NF1441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1441_high_119 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 38451608 - 38451829
Alignment:
| Q |
1 |
actctgcaggtcatccactcgcattaacatgataatggagtgctttattgaatgagaattgagcagcacctataatgatgtatatctaatataattttag |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38451608 |
actctacaggtcatccactcgcattaacatgataatggagtgctttattgaatgagaattgagcagcacctataatgatgtatatctaatataattttag |
38451707 |
T |
|
| Q |
101 |
gctattgtattgctaaatactaactactttctttgttgcacttgggacccttttccagggttgacctatgccatcagccagacgatgacgatgactatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38451708 |
gctattgtattgctaaatactaactactttctatgttgcacttgggtcccttttccagggttgacctatgccatcagccagacgatgacgatgactatga |
38451807 |
T |
|
| Q |
201 |
aggaagtttctctgaggaacct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38451808 |
aggaagtttctctgaggaacct |
38451829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University